View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_39 (Length: 242)
Name: NF4928_1D_low_39
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 39 - 236
Target Start/End: Original strand, 26433932 - 26434129
Alignment:
| Q |
39 |
ttgtgtttgtgaaatgagaacctaacttgtgaataagcttgagtgggttttctgtatcaagtaaggttatactttgggattgatctcaagggttttgttt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26433932 |
ttgtgtttgtgaaatgagaacctaacttgtgaataagcttgagtaggttttctgtatctagttaggttatactttgggattgatctcaagggttttgttt |
26434031 |
T |
|
| Q |
139 |
atagtcctttctggccccnnnnnnngtaacaattttggcagccttatccaatcagtttctatagtaaggggtgcatatgacttatttttactagaata |
236 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26434032 |
atagtcctttctggcccctttttttgtaacaattttggcagccttatccaatcagtttctatagtaaggggtgcatatgacttatttttactagaata |
26434129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University