View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_44 (Length: 233)
Name: NF4928_1D_low_44
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 3653667 - 3653880
Alignment:
| Q |
12 |
atgaatggctcatgtttttcttcatatatttgaattataactcataaatgaagacgttgctgtggnnnnnnn-gtaccgtggattttaaaattgggaatt |
110 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | || |
|
|
| T |
3653667 |
atgaatgactcatttttttcttcatatatttgaattataactcataaatgaagacgttgctgtgaaaaaaaaagtactgtggattttaaaattggcagtt |
3653766 |
T |
 |
| Q |
111 |
tatgtttaaagaagaagtgatgggagaaagaaaataaatgcatgagatatgtctacacgagttttctcaatattaaaatatcaaacactttctttttgcg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3653767 |
tatgtttaaagaagaagtgatgggagaaagaaaataaatgaatgacatatgtctacacgagttttctcaatattaaaatatcaaacactttctttttgcg |
3653866 |
T |
 |
| Q |
211 |
atgaaacttattaa |
224 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3653867 |
atgaaacttattaa |
3653880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University