View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_51 (Length: 225)
Name: NF4928_1D_low_51
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_51 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 79 - 225
Target Start/End: Complemental strand, 53788241 - 53788094
Alignment:
| Q |
79 |
tgtaatggaggagaatgtcaaattgaatcaagatgctggaagtgattaaatattggaaagaaaattattcaaatactcaaataatggaa-cagttgattt |
177 |
Q |
| |
|
|||||| || |||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
53788241 |
tgtaatagaagagaatgttaaattgaatcaagatgctggaagtgattaaatattgggaaaaaaattattgcaatactcaaataatggaaccggttgattt |
53788142 |
T |
|
| Q |
178 |
tcccaacaagcatttgcaaatgaatttaacgaagtcctagatagatgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53788141 |
tcccaacaagcatttgcaaatgaatttaacgaagtcctggatagatgg |
53788094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 53788269 - 53788240
Alignment:
| Q |
1 |
ataatactaatgtatttccatggatttatg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53788269 |
ataatactaatgtatttccatggatttatg |
53788240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University