View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_56 (Length: 213)
Name: NF4928_1D_low_56
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 4133265 - 4133456
Alignment:
| Q |
1 |
ggtcaaggcattccttttccatctttctaatctctcaaagttaccgcctatatagatgtggattggggcagctgccaagtttctaaaaaatacacaaccg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133265 |
ggtcaaggcattccttttccatctttctaatctctcaaagttaccgcctatgtagacgtggattggggcagctgccaagtttctaaaaaatacacaaccg |
4133364 |
T |
|
| Q |
101 |
attatggcatatttcttggtgactccttgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaatacatt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4133365 |
attatggcatatttcttggtgactccttgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaatacatt |
4133456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 126 - 188
Target Start/End: Complemental strand, 41091908 - 41091846
Alignment:
| Q |
126 |
cttgatagattggaaattgaagaagcaagctattgttgctcgctctttagcagaggctgaata |
188 |
Q |
| |
|
|||||||| ||||||| ||||||| || |||||||||||||||||| |||||||||||||| |
|
|
| T |
41091908 |
cttgatagcttggaaaccgaagaagtaaactattgttgctcgctcttctgcagaggctgaata |
41091846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 65 - 118
Target Start/End: Complemental strand, 41091958 - 41091905
Alignment:
| Q |
65 |
ggggcagctgccaagtttctaaaaaatacacaaccgattatggcatatttcttg |
118 |
Q |
| |
|
|||| ||||||||||||||| |||||| ||||||| |||| |||||||||||| |
|
|
| T |
41091958 |
ggggaagctgccaagtttcttaaaaattcacaaccacttattgcatatttcttg |
41091905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University