View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_57 (Length: 209)
Name: NF4928_1D_low_57
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 4 - 201
Target Start/End: Original strand, 4708164 - 4708361
Alignment:
| Q |
4 |
tcaaaagtatgtttcagccagtaacctgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccat |
103 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4708164 |
tcaaaagtatgattcagccagtaacttgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccac |
4708263 |
T |
|
| Q |
104 |
tttaggatcaattagggcgtcaacgactatctgcaaaattatcatggattcttctttnnnnnnnntggtcatggattctataccattaaggttttcat |
201 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
4708264 |
tttaggatcaagtagggtgtcaacgactatctgcaaaatgatcatggattcttctttaaaaaaaatgatcatggattctataccattaaggttttcat |
4708361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 25 - 140
Target Start/End: Original strand, 4745869 - 4745984
Alignment:
| Q |
25 |
taacctgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccattttaggatcaattagggcgtc |
124 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| |||||| |||||||||||| |||||| ||||| ||| ||||||||||| ||||| ||| |
|
|
| T |
4745869 |
taacatgcgactttatgtatctctctattaggtcagcaagagctctaatcagtgactttggatcatatattatacccactttaggatcaagtagggagtc |
4745968 |
T |
|
| Q |
125 |
aacgactatctgcaaa |
140 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
4745969 |
aacaactatctgcaaa |
4745984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University