View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_58 (Length: 204)
Name: NF4928_1D_low_58
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_58 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 22 - 181
Target Start/End: Complemental strand, 7857030 - 7856871
Alignment:
| Q |
22 |
acaccctccttaatttaatcagagttcttttgagatgtactcatgaaaatacaacaatgttaaattttgagatagagnnnnnnncattcattacgctcat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7857030 |
acaccctccttaatttaatcagagttcttttgagatgtactcatgaaaatacaacaatgttaaattttgagatagagtttttttcattcattacgctcat |
7856931 |
T |
 |
| Q |
122 |
actcgactcgtgatattaacctttgcaattacgtagaaatgatacttgtttcatacaaag |
181 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7856930 |
actcgactcgtgatattagcctttgcaattatgtagaaatgatacttgtttcatacaaag |
7856871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University