View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_59 (Length: 204)
Name: NF4928_1D_low_59
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 38815628 - 38815437
Alignment:
| Q |
1 |
tatgccaggttgtgaggcag--tgttggaaattttgccttgattgtggtctgcccctagccatcttaaatttggcttttaaatttccttcattgcagctt |
98 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38815628 |
tatgccaggttgtgaggcagggtgttggaaattttgccttgattgtggtcttcccctagccatcttaaatttggcttttaaatttccttcattgcagctt |
38815529 |
T |
|
| Q |
99 |
cgagcaccttaattttgctgggtgtgagaggctgggttagtcctacacagcctagagatctaaatagccgtgaagggcctc-ttgtgtggtg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38815528 |
cgagcaccttaattttgctgggtgtgagaggctgggttagtcctacacagcctagagatctaaatagccgtgaagggcctctttgtgtggtg |
38815437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University