View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_60 (Length: 203)
Name: NF4928_1D_low_60
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_60 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 45792204 - 45792382
Alignment:
| Q |
19 |
ttgttacttattgaataaagcataaagacatatgtgtaatcttggcaaagatcacaatgcaggcatttgactatgatacttctaatttagaactacagaa |
118 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45792204 |
ttgttacttattgaataatgcattaagacatatgtgtaatcttggcaaagatcacaatgcaggcatttgactatgatacttctaatttagaactacagaa |
45792303 |
T |
|
| Q |
119 |
acatgtatattgtccccatggttcccaatggatgcaaaattgtctttctattaatttagatatgaatacatccgcaata |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45792304 |
acatgtatattgtccccatggttcccaatggatgcaaaattgtctttctattaatttagatatgaatacatccgcaata |
45792382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University