View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4928_1D_low_60 (Length: 203)

Name: NF4928_1D_low_60
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4928_1D_low_60
NF4928_1D_low_60
[»] chr4 (1 HSPs)
chr4 (19-197)||(45792204-45792382)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 19 - 197
Target Start/End: Original strand, 45792204 - 45792382
Alignment:
19 ttgttacttattgaataaagcataaagacatatgtgtaatcttggcaaagatcacaatgcaggcatttgactatgatacttctaatttagaactacagaa 118  Q
    |||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45792204 ttgttacttattgaataatgcattaagacatatgtgtaatcttggcaaagatcacaatgcaggcatttgactatgatacttctaatttagaactacagaa 45792303  T
119 acatgtatattgtccccatggttcccaatggatgcaaaattgtctttctattaatttagatatgaatacatccgcaata 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45792304 acatgtatattgtccccatggttcccaatggatgcaaaattgtctttctattaatttagatatgaatacatccgcaata 45792382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University