View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_8 (Length: 380)
Name: NF4928_1D_low_8
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_8 |
 | |
|
| [»] scaffold1113 (2 HSPs) |
| | |
|
| [»] scaffold0961 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 176; Significance: 1e-94; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 176; E-Value: 1e-94
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 32684475 - 32684284
Alignment:
| Q |
1 |
atgtcaatttctaaatgcttagttctttcattgaatacaatagatgttatgtaaatgacactttgactatcacaatataacgcaatgaggtcttgtgctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32684475 |
atgtcaatttctaaatgcttagttctttcattgaataatatagatgttatgtaaatgacactttgactatcaaaatataacgcaatgaggtcttgtgctt |
32684376 |
T |
|
| Q |
101 |
cgaagttctttacggtcattgtcaacctcctctttatattcagccttggatttcagcgcacaattcaactgccagatctgctggtttagagg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32684375 |
cgaagttctttacggtcattgtcaacctcctctttatattcagccttggatttcagcgcacaattcagctgccagatctgctggtttagagg |
32684284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 1 - 135
Target Start/End: Original strand, 32559948 - 32560082
Alignment:
| Q |
1 |
atgtcaatttctaaatgcttagttctttcattgaatacaatagatgttatgtaaatgacactttgactatcacaatataacgcaatgaggtcttgtgctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
32559948 |
atgtcaatttctaaatgcttagttctttcattgaatacaatgcatgttatgtaaatgacactttcactatcacaatataacgcaacgaggtcttgtgctt |
32560047 |
T |
|
| Q |
101 |
cgaagttctttacggtcattgtcaacctcctcttt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32560048 |
cgaagttctttacggtcattgtcaacctcctcttt |
32560082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 250 - 366
Target Start/End: Complemental strand, 32684226 - 32684110
Alignment:
| Q |
250 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttgagat |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684226 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttgagat |
32684127 |
T |
|
| Q |
350 |
tcttacaatgatgtcca |
366 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
32684126 |
tcttacaatgatatcca |
32684110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 98 - 192
Target Start/End: Complemental strand, 32692276 - 32692182
Alignment:
| Q |
98 |
cttcgaagttctttacggtcattgtcaacctcctctttatattcagccttggatttcagcgcacaattcaactgccagatctgctggtttagagg |
192 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32692276 |
cttcaaagttctttacggtcattgtcaacctcctctttatattcaaccttgcatttcagcacacaattcagctgccagatctgctggtttagagg |
32692182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 250 - 284
Target Start/End: Complemental strand, 32692124 - 32692090
Alignment:
| Q |
250 |
tagaatcaaaattattgttagagaaaaacttgcct |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32692124 |
tagaatcaaaattattgttagagaaaaacttgcct |
32692090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 250 - 323
Target Start/End: Original strand, 61 - 134
Alignment:
| Q |
250 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctac |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
61 |
tagaatcaaaattattgttagagaaaaacttgcctcgaatgctaaatcagcatccggctcattcacgcgtctac |
134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 284
Target Start/End: Original strand, 1872 - 1904
Alignment:
| Q |
252 |
gaatcaaaattattgttagagaaaaacttgcct |
284 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1872 |
gaatcaaaatcattgttagagaaaaacttgcct |
1904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0961 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0961
Description:
Target: scaffold0961; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 284
Target Start/End: Complemental strand, 1745 - 1713
Alignment:
| Q |
252 |
gaatcaaaattattgttagagaaaaacttgcct |
284 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
1745 |
gaatcaaaatcattgttagagaaaaacttgcct |
1713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University