View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_1D_low_9 (Length: 371)
Name: NF4928_1D_low_9
Description: NF4928_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_1D_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 207 - 366
Target Start/End: Complemental strand, 15013194 - 15013034
Alignment:
| Q |
207 |
gattcttgcatagaaattgaatgaagatgtattgaagataaataagagtacacaattttttg-gtcgttaaatgtatgcgatagagtaactatagtcctc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15013194 |
gattcttgcatagaaattgaatgaagatgtattgaaaataaataagagtacacaattttttttgtcattaaatgtatgcgatagagtaactatagtcctc |
15013095 |
T |
 |
| Q |
306 |
gaccgtctcaaatttacataaacatcattgaatgtatcttccattcgtaagtataatctag |
366 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
15013094 |
gaccgtctcaaattttcataaacatcattgaatgtatcttccattcgtaactatagtctag |
15013034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 22 - 128
Target Start/End: Complemental strand, 15013379 - 15013273
Alignment:
| Q |
22 |
agactggcagggcacaatgagagaagaagaaagagctccaatgattctgttgggaggaattcctcacaaggtaaaacttgactcttacttattgcaaaat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15013379 |
agactggcagggcacaatgagagaagaagaaagagctcccatgattctgttgggaggaattcctcacaaggtaaaacttgactcttacttattgcaaaat |
15013280 |
T |
 |
| Q |
122 |
ctaatga |
128 |
Q |
| |
|
||||||| |
|
|
| T |
15013279 |
ctaatga |
15013273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University