View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_2D_high_4 (Length: 337)
Name: NF4928_2D_high_4
Description: NF4928_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_2D_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 68 - 324
Target Start/End: Original strand, 51524351 - 51524607
Alignment:
| Q |
68 |
gtgtgtcagtgtcatactcggtgtctgtgtggtgccagcggtatcagttcctctgtttattctattcttctttccattgtgatcactttagctaattgtt |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51524351 |
gtgtgtcagtgtcatactcggtgtctgtgtggtgccagcggtatcagttcctctgtttattctattcttctttccattgtgatcactttagctaattgtt |
51524450 |
T |
|
| Q |
168 |
ttgttccacagagaaggataacagcacaggaaaactaaactgtgatctaaggacatggctgagtgctgttcttgtgtatccagacacatgtatagaagga |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51524451 |
ttgttccacagagaaggataacagcacaggaaaactaaactgtgatctaaggacatggctgagtgctgttcttgtgtatccagacacatgtatagaagga |
51524550 |
T |
|
| Q |
268 |
ttagaaggttcaattgtaaagggtcttatatcctctggtctcgatcatgtgatgtcc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
51524551 |
ttagaaggttcaattgtaaagggtcttatatcctctggtctcgatcatgtaatgtcc |
51524607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 175 - 275
Target Start/End: Original strand, 51530642 - 51530742
Alignment:
| Q |
175 |
acagagaaggataacagcacaggaaaactaaactgtgatctaaggacatggctgagtgctgttcttgtgtatccagacacatgtatagaaggattagaag |
274 |
Q |
| |
|
|||| |||| ||||||| || ||||| |||| || ||||||||| |||||||| ||||||||||||||| || ||||||| ||| ||||||||||| ||| |
|
|
| T |
51530642 |
acagggaagaataacagtactggaaatctaagctctgatctaagaacatggctcagtgctgttcttgtgaatacagacacttgtttagaaggattacaag |
51530741 |
T |
|
| Q |
275 |
g |
275 |
Q |
| |
|
| |
|
|
| T |
51530742 |
g |
51530742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University