View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_2D_high_9 (Length: 263)
Name: NF4928_2D_high_9
Description: NF4928_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_2D_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 47 - 248
Target Start/End: Original strand, 4708164 - 4708365
Alignment:
| Q |
47 |
tcaaaagtatgtttcagccagtaacctgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccac |
146 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4708164 |
tcaaaagtatgattcagccagtaacttgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccac |
4708263 |
T |
|
| Q |
147 |
tttaggatcaattagggcgtcaacgactatctgcaaaattatcatggattcttctttnnnnnnnntggtcatggattctataccattaaggttttcatat |
246 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
4708264 |
tttaggatcaagtagggtgtcaacgactatctgcaaaatgatcatggattcttctttaaaaaaaatgatcatggattctataccattaaggttttcatat |
4708363 |
T |
|
| Q |
247 |
ca |
248 |
Q |
| |
|
|| |
|
|
| T |
4708364 |
ca |
4708365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 68 - 183
Target Start/End: Original strand, 4745869 - 4745984
Alignment:
| Q |
68 |
taacctgcgacttcgtgtatctctctattaggtcagcaagatctctaaccagtgactttgggtcatatcttataaccactttaggatcaattagggcgtc |
167 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||| |||||| |||||||||||| |||||| ||||| ||||||||||||||| ||||| ||| |
|
|
| T |
4745869 |
taacatgcgactttatgtatctctctattaggtcagcaagagctctaatcagtgactttggatcatatattatacccactttaggatcaagtagggagtc |
4745968 |
T |
|
| Q |
168 |
aacgactatctgcaaa |
183 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
4745969 |
aacaactatctgcaaa |
4745984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University