View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_2D_low_16 (Length: 300)
Name: NF4928_2D_low_16
Description: NF4928_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_2D_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 100 - 268
Target Start/End: Complemental strand, 39149329 - 39149162
Alignment:
| Q |
100 |
cttgaggtcatataaaatgggtaattctgattgtgattgagattagaacttagatgttattggtcttatctgtagggtataactttatttcaaatcaaat |
199 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39149329 |
cttgaggtcatacaaaatgggtaattgtgattgtgattgagattaaaacttagatgttattggtcttatctgtagg-tataactttatttcaaatcaaat |
39149231 |
T |
 |
| Q |
200 |
atgtgtgtcggtattaagaagataagtagacgtaagaatatgataaatctctttgatagaataaccatc |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39149230 |
atgtgtgtcggtattaagaagataagtagatgtaagaatatgataaatctttttgatagaataaccatc |
39149162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University