View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_2D_low_21 (Length: 270)
Name: NF4928_2D_low_21
Description: NF4928_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_2D_low_21 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 59 - 270
Target Start/End: Original strand, 38597303 - 38597514
Alignment:
| Q |
59 |
atgaagtagcagcatggttcagagtcagaatggtagaaattaggataagaaaaaggtataaatatacccagcgtcataagcaaattgataatcaatatca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
38597303 |
atgaagtagcagcatggttcagagtcagaatggtagaaattaggataagaaaaaagtataaatatacccatcgtcataagcaaattgctaatcaatatca |
38597402 |
T |
 |
| Q |
159 |
atatacactgtaaaaacagaaacaactattactgataacttacgtggtttaatctttcttgcagaagatgtaattaaatcagccattttcttttcaacca |
258 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
38597403 |
atataaactgtaaaaacagaaacaactattactgataacttacgtggtttaatctttcttgcagaagatgtaattaaatcagccactttcttttcaacca |
38597502 |
T |
 |
| Q |
259 |
cttggctatgat |
270 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38597503 |
cttggctatgat |
38597514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 65
Target Start/End: Complemental strand, 38597818 - 38597773
Alignment:
| Q |
20 |
gggatttgatcttagaagacgaacaaaaaatactgcttaatgaagt |
65 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38597818 |
gggatttgaacttagaagacgaacaaaaaatactgcttaatgaagt |
38597773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University