View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_2D_low_25 (Length: 254)
Name: NF4928_2D_low_25
Description: NF4928_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_2D_low_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 2437816 - 2437599
Alignment:
| Q |
18 |
gaaacttcaaaacataagtcacattttttgttctaaagttatgtatcatattacaatcgcaaattaagat---aagtatttctattttaatgtgatttgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
2437816 |
gaaacttcaaaacataagtcacattttttgttctaaagttatgtatcatattacaatcgcaaattaagatgataaatatttctattttaatgtgatttgg |
2437717 |
T |
|
| Q |
115 |
ttcggttaccagttgaacaagttttgacctgacctattgttaactttagtttgcttgatgctaaagttacaattaggccagggaatgccatnnnnnnnta |
214 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| || |
|
|
| T |
2437716 |
ttcggttaccagttgaacaagtcttgacctgacctattgttaactatagtttgcttaatgctaaagttacaattaggccagggaatgccat-aaaaaata |
2437618 |
T |
|
| Q |
215 |
ctagttcatgattattttc |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2437617 |
ctagttcatgattattttc |
2437599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University