View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_2D_low_9 (Length: 350)
Name: NF4928_2D_low_9
Description: NF4928_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_2D_low_9 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 243 - 350
Target Start/End: Original strand, 13226954 - 13227061
Alignment:
| Q |
243 |
cttcattatgtgcattatgatctatgacattatcttatcttatcttaggagtatatagatgtataaagtgagtgagggagtatgaacatcactttgatac |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13226954 |
cttcattatgtgcattatgatctatgacattatcttatcttatcttaggagtatatagatgtataaagtgagtgagggagtatgaacatcactttgatac |
13227053 |
T |
 |
| Q |
343 |
ataacttt |
350 |
Q |
| |
|
|||||||| |
|
|
| T |
13227054 |
ataacttt |
13227061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 6 - 91
Target Start/End: Original strand, 13226749 - 13226834
Alignment:
| Q |
6 |
tttggtgttgctaagttgattcaaacggacgagtctatgtctgttattgctggttcctatggttacattgctcccggtaagtatca |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
13226749 |
tttggtgttgctaagttgattcaaacggacgagtctatgtctgttattgctggttcctatggttacattgctccgggtaaggatca |
13226834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University