View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_14 (Length: 437)
Name: NF4928_high_14
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 3e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 258 - 431
Target Start/End: Complemental strand, 46266945 - 46266772
Alignment:
| Q |
258 |
accaggtatataccactattcatattcatataagaatgattatgtttttcccatttacgtatatgtttttattgatgtcaatcatgcattgaactgcatt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46266945 |
accaggtatataccactattcatattcatataagaatgattatgtttttcccatttacgtatatgtttttattgatgtcaatcatgcattgaactgcatt |
46266846 |
T |
|
| Q |
358 |
gtcgttttgatgaacacgttgatgcaggtattgattgccgttttgatttccgctccgctggtgattcatttcag |
431 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46266845 |
gtcgttttgatgaacatgttgatgcaggtattgattgcggttttgatttccgctccgctggtgaatcatttcag |
46266772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University