View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_19 (Length: 371)
Name: NF4928_high_19
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 7 - 166
Target Start/End: Original strand, 15013035 - 15013194
Alignment:
| Q |
7 |
tagattatacttacgaatggaagatacattcaatgatgtttatgtaaatttgagacggtcgaggactatagttactctatcgcatacatttaacgaccnn |
106 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
15013035 |
tagactatagttacgaatggaagatacattcaatgatgtttatgaaaatttgagacggtcgaggactatagttactctatcgcatacatttaatgacaaa |
15013134 |
T |
|
| Q |
107 |
nnnnnttgtgtactcttatttatcttcaatacatcttcattcaatttctatgcaagaatc |
166 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15013135 |
aaaaattgtgtactcttatttattttcaatacatcttcattcaatttctatgcaagaatc |
15013194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 245 - 351
Target Start/End: Original strand, 15013273 - 15013379
Alignment:
| Q |
245 |
tcattagattttgcaataagtaagagtcaagttttaccttgtgaggaattcctcccaacagaatcattggagctctttcttcttctctcattgtgccctg |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15013273 |
tcattagattttgcaataagtaagagtcaagttttaccttgtgaggaattcctcccaacagaatcatgggagctctttcttcttctctcattgtgccctg |
15013372 |
T |
|
| Q |
345 |
ccagtct |
351 |
Q |
| |
|
||||||| |
|
|
| T |
15013373 |
ccagtct |
15013379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University