View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_26 (Length: 285)
Name: NF4928_high_26
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 3119083 - 3119011
Alignment:
| Q |
18 |
atgggtttggtgttagaaatagtatgatggaaaatggaagaaagagaaaaacattcaattcacgttacgaatc |
90 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3119083 |
atgggtttggtgttagaaatagtaagatggaaaatggaagaaagagaaaaacattcaattcacgttacgaatc |
3119011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 3118944 - 3118898
Alignment:
| Q |
157 |
gatgttcaagtatgatcaccgctttctatttttaatccaactcttct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3118944 |
gatgttcaagtatgatcaccgctttctatttttaatccaactcttct |
3118898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University