View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_27 (Length: 263)
Name: NF4928_high_27
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 246
Target Start/End: Complemental strand, 4775805 - 4775570
Alignment:
| Q |
8 |
ccaagaatattcttagaaaacattggagctacatctctatgtgcaaaccctgtctttcagtactctaggatgaagcatattgccatagattatcattttg |
107 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4775805 |
ccaacaatattctaagacaacattggagctacatatctatgtgcaaaccctgtctttca---ctctaggatgaagcatattgccatagattatcattttg |
4775709 |
T |
 |
| Q |
108 |
ttcgcgatctcgttgccgccaagaagcttcaagtttcacatgtcccaacaagtcatcaaccagtcgatcttctaacaaagccgttatcctcggtacggca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4775708 |
ttcgcgatctcgttgccgccaagaagcttcaagtttcacatgtcccaacaagtcatcaaccagtcgatcttctaacaaagccgttatcctcggtacggca |
4775609 |
T |
 |
| Q |
208 |
tcacttccttaaagacaagattggagttattgatgatac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4775608 |
tcacttccttaaagacaagattggagttattgatgatac |
4775570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 14 - 246
Target Start/End: Complemental strand, 43061160 - 43060928
Alignment:
| Q |
14 |
atattcttagaaaacattggagctacatctctatgtgcaaaccctgtctttcagtactctaggatgaagcatattgccatagattatcattttgttcgcg |
113 |
Q |
| |
|
||||||| ||| |||||| ||||||||| |||||||||||||||||| ||||| || ||||||||| || |||||||||||||||||||||||| ||| |
|
|
| T |
43061160 |
atattctcagacaacattagagctacatatctatgtgcaaaccctgtttttcacta---taggatgaaacacattgccatagattatcattttgtttgcg |
43061064 |
T |
 |
| Q |
114 |
atctcgttgccgc---caagaagcttcaagtttcacatgtcccaacaagtcatcaaccagtcgatcttctaacaaagccgttatcctcggtacggcatca |
210 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||||||||||| | | ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
43061063 |
atctcgttgctgctgccaagaagcttcaagtttcacatgtcccaacaagtcatcagctacccgatcttctcacaaagccgttatcctcggtacgacatca |
43060964 |
T |
 |
| Q |
211 |
cttccttaaagacaagattggagttattgatgatac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43060963 |
cttccttaaagacaagattggagttattgatgatac |
43060928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 45192874 - 45192914
Alignment:
| Q |
26 |
aacattggagctacatctctatgtgcaaaccctgtctttca |
66 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
45192874 |
aacattggagctacatatctatgtgcaaaccctgtccttca |
45192914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University