View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_34 (Length: 238)
Name: NF4928_high_34
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_34 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 52800160 - 52800054
Alignment:
| Q |
1 |
atggaaaatcagttgaaacaacgcaaaaccattgtttctagaaagagaaatcctcgctctactacaactgctagacctcaacaggtctctttttcttcct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52800160 |
atggaaaatcagttgaaacaacgcaaaaccattgtttctagaaagagaaatcctcgctctactacaactgctagacctcaacaggtctccctttcttcct |
52800061 |
T |
 |
| Q |
101 |
cattatg |
107 |
Q |
| |
|
|||||| |
|
|
| T |
52800060 |
tattatg |
52800054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 103 - 206
Target Start/End: Complemental strand, 52800017 - 52799920
Alignment:
| Q |
103 |
ttatggaacaaatatgaactttatagtatcaatgtcaatgtcaatgaaatgaagccttttgcttacatattgtgcactttgttttttcaatcttcaacat |
202 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52800017 |
ttatggaacaaatatgaactttatagt------gtcaatgtcaatgaaatcaagccttttgcttacatattgtgcactttgttttttcaatcttcaacat |
52799924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University