View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_35 (Length: 238)
Name: NF4928_high_35
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 34 - 220
Target Start/End: Complemental strand, 31331749 - 31331563
Alignment:
| Q |
34 |
gttcatgggaaagaatggaggaaggtaaaatcaaagtgtttccattgttctgtttttctttagatccacttgcatgttagattaagtgtgatttgggaag |
133 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31331749 |
gttcatgggaaagaatggaggaaggaaaaatcaaagtctttccattgttctatttttctttagatccacttgcatgttagattaagtgagatttgggaag |
31331650 |
T |
 |
| Q |
134 |
ccgtgagtggaggaagggaatgagggaaatctcaagtttggagagagaaaggggtggatgaaatgagaggaatttaacgggatgtta |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31331649 |
ccgtgagtggaggaaggggatgagggaaatctcaagtttggagagagaaaggagtggatgaaatgagaggaatttaacgggatgtta |
31331563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University