View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_40 (Length: 222)
Name: NF4928_high_40
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 50710262 - 50710455
Alignment:
| Q |
1 |
tatgttgtgaggataatgtatatagaactttattcgcgatggttgcggtctagcaagagcgctttagtttatttctcggatggccttgtggcaaaactag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50710262 |
tatgttgtgaggataatgtatatagaactttattcgcgatggttgcggtcgagcaagagcgctttagtttatttctcggatggccttgtggcaaaactag |
50710361 |
T |
|
| Q |
101 |
aatacacgtggaaaaatcctgacgatgtgatgagctatggctgcgatcgagtaagagcgttttagtttgttgctcggccgagactcttaagagt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50710362 |
aatacacgtggaaaaatcctgacgatgtgatgagctatggctgcgatcgagtaagagcgttttagttcattgctcggccgagactcttaagagt |
50710455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University