View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4928_high_41 (Length: 219)

Name: NF4928_high_41
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4928_high_41
NF4928_high_41
[»] chr2 (2 HSPs)
chr2 (156-201)||(43540236-43540281)
chr2 (18-53)||(43540098-43540133)


Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 43540236 - 43540281
Alignment:
156 tctcaactttaacaacctcaatttcctcaaattcactgtaaccctc 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
43540236 tctcaactttaacaacctcaatttcctcaaattcactgtaaccctc 43540281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 43540098 - 43540133
Alignment:
18 ttcacattgctttgttcattttccaccttcatcttc 53  Q
    ||||||||||||||||||||||||||||||||||||    
43540098 ttcacattgctttgttcattttccaccttcatcttc 43540133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University