View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_41 (Length: 219)
Name: NF4928_high_41
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 43540236 - 43540281
Alignment:
| Q |
156 |
tctcaactttaacaacctcaatttcctcaaattcactgtaaccctc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540236 |
tctcaactttaacaacctcaatttcctcaaattcactgtaaccctc |
43540281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 53
Target Start/End: Original strand, 43540098 - 43540133
Alignment:
| Q |
18 |
ttcacattgctttgttcattttccaccttcatcttc |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540098 |
ttcacattgctttgttcattttccaccttcatcttc |
43540133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University