View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_high_42 (Length: 218)
Name: NF4928_high_42
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_high_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 24336382 - 24336570
Alignment:
| Q |
18 |
ctaagagtgttctatcgagtcttcgtctcaaatgttcttgttctgataagaattctgttgatataaatgaccatgcaagtggaatcagttttaataacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24336382 |
ctaagagtgttctatcgagtcttcgtctcaaatgctcttgttctgataagaattctgttgatataaatgaccatgcaagtgaaatcagttttaataacaa |
24336481 |
T |
 |
| Q |
118 |
aacttctaagtatggtgcagttcaaggtaaaacaacaccgaaaaaagtgtttaatcttggtcttgatgatgatctttcagttagaataa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24336482 |
aacttctaagtatggtgcagttcaaggtaaaacaacgccgaaaaaagtgtttaatcttggtcttgatgatgatctttcagtaagaataa |
24336570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 17745412 - 17745353
Alignment:
| Q |
46 |
caaatgttcttgttctgataagaattctgttgatataaatgaccatgcaagtggaatcag |
105 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||| ||| |||||| ||| |||||| |
|
|
| T |
17745412 |
caaatgctcttgttatgataagaattctgttgatgtaagtgatcatgcaggtgaaatcag |
17745353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University