View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4928_low_26 (Length: 285)

Name: NF4928_low_26
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4928_low_26
NF4928_low_26
[»] chr7 (2 HSPs)
chr7 (18-90)||(3119011-3119083)
chr7 (157-203)||(3118898-3118944)


Alignment Details
Target: chr7 (Bit Score: 69; Significance: 5e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 3119083 - 3119011
Alignment:
18 atgggtttggtgttagaaatagtatgatggaaaatggaagaaagagaaaaacattcaattcacgttacgaatc 90  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
3119083 atgggtttggtgttagaaatagtaagatggaaaatggaagaaagagaaaaacattcaattcacgttacgaatc 3119011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 3118944 - 3118898
Alignment:
157 gatgttcaagtatgatcaccgctttctatttttaatccaactcttct 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
3118944 gatgttcaagtatgatcaccgctttctatttttaatccaactcttct 3118898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University