View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_low_28 (Length: 258)
Name: NF4928_low_28
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 40 - 239
Target Start/End: Original strand, 46933512 - 46933711
Alignment:
| Q |
40 |
agataattgaaatttacaggtgtggaaagacaatggtctaagatgaattgttgaacttgttccgtaattgagccttcgccgcacgccctaaattgaaatt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46933512 |
agataattgaaatttacaggtgtggaaagacaatggtctaagatgaattgttgaacttgttccgtaattgagccttcgccgcacgccctaaattgaaatt |
46933611 |
T |
 |
| Q |
140 |
gcataagctaagtattattgcagttaaacttaaatatatttgttaatgaaaacagaaagagaagagaaagtgtacttggcatgggagattaagcagtagg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
46933612 |
gcataagctaagtattattgcagttaaacttaaatatatttgttaacgaaaacagaaagagaagagaaagtttacttggcatgtgagattaagcagtagg |
46933711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University