View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_low_29 (Length: 253)
Name: NF4928_low_29
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 4776289 - 4776037
Alignment:
| Q |
1 |
tcccatggccacctcattctgctcacaacctaaacccgactccacatactgtgacagtaaggaatttcgcagtatacttggtgccttacactacctttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4776289 |
tcccatggccacctcattctgctcacaacctaaacccgactccacatactgtgacagtaaggaatttcgcagtatgcttggtgccttacactacctttca |
4776190 |
T |
|
| Q |
101 |
atcactcgcccagacatagcatttccagtgaataaactagcataacaaatgcaagctcctactgtgacagatatgcaagccttgaagagagtattgcgct |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776189 |
atcactcgcccagacattgcatttccagtgaataaactagcataacaaatgcaagctcctactgtgacagatatgcaagccttgaagagagtattgcgct |
4776090 |
T |
|
| Q |
201 |
atctcaaatccaccatctccaatggactccatctcacaagatcttcaaataca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4776089 |
atctcaaatccaccatctccaatggactccatctcacaagatcttcaaataca |
4776037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University