View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_low_33 (Length: 242)
Name: NF4928_low_33
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 46 - 124
Target Start/End: Original strand, 46267318 - 46267396
Alignment:
| Q |
46 |
ctaaattatatgtcttaagatggaacaagtgtttactttgcttattacaacctttgatctcttgttcactctaattctt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46267318 |
ctaaattatatgtcttaagatggaacaagtgtttactttgcttattacaacctttgatctcttgttcactctaattctt |
46267396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 194 - 226
Target Start/End: Original strand, 46267401 - 46267433
Alignment:
| Q |
194 |
aattgtaatatatgaaatataaatataaattaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46267401 |
aattgtaatatatgaaatataaatataaattaa |
46267433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 46267277 - 46267305
Alignment:
| Q |
1 |
ttgtctaacaaactaaattctatgtcctt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46267277 |
ttgtctaacaaactaaattctatgtcctt |
46267305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University