View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4928_low_38 (Length: 230)
Name: NF4928_low_38
Description: NF4928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4928_low_38 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 7 - 230
Target Start/End: Original strand, 51724705 - 51724931
Alignment:
| Q |
7 |
ctttgttccataataagttcttgaaatttaaccgatcaattcgnnnnnnnn-agtttaatatttgtgaaatgatatatatttggttcatataaattcgtg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51724705 |
ctttgttccataataagttcttgaaatttaaccgatcaattcgtttttttttagtttaatatttgtgaaatgatatatatttggttcatataaattcgtg |
51724804 |
T |
 |
| Q |
106 |
annnnnnnnnnnnnnnat--accgaaaaaggcacatatacagcaaaaatccacctagaaaattttgcctaatcgataatattaagatagcatatgaaatt |
203 |
Q |
| |
|
| | || ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51724805 |
attttttatttttcttttttactgaaaaaggcacatctacagcaaaaatccacctagaaaattttgcctgatcgataatattaagatagcatatgaaatt |
51724904 |
T |
 |
| Q |
204 |
tgacctaacttgtaaaattttctttgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
51724905 |
tgacctaacttgtaaaattttctttgt |
51724931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University