View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4929-Insertion-10 (Length: 233)
Name: NF4929-Insertion-10
Description: NF4929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4929-Insertion-10 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 233
Target Start/End: Original strand, 24999285 - 24999510
Alignment:
| Q |
8 |
ctatcattccgagattatcaactaataacttttttatttcaacccatataaatcattaagatattagttaacttgtagtggtaaatagcagcccaggtag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24999285 |
ctatcattccgagattatcaactaataacttttttatttcaacccatataaatcattgagatattagttaacttgtagtggtaaatagcagcccaggtag |
24999384 |
T |
 |
| Q |
108 |
tagcataatacttgttcatatgacaatattatctatggtatgaggaaagtacaaagcagaatatcattataatattacatatcaatcaagtgatcaactt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24999385 |
tagcataatacttgttcatatgacaatattatctatggtaagaggaaagtacaaagcagaatatcattataatattacatatcaatcaagtgatcaactt |
24999484 |
T |
 |
| Q |
208 |
atacacctacaacatactcgtaaaca |
233 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
24999485 |
acacacctacaacatactcgtaaaca |
24999510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University