View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4929-Insertion-4 (Length: 298)
Name: NF4929-Insertion-4
Description: NF4929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4929-Insertion-4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 57 - 298
Target Start/End: Original strand, 52387801 - 52388044
Alignment:
| Q |
57 |
gataacctaggaaagacaacattatacattaactttagaggcattccgacatgataactgatgcaaaaataatgactgaggccattaatacaatacaaaa |
156 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52387801 |
gataacctagcaaagacaacattatacattaacattagaggcattccgacatgataactgatacaaaaataatgactgagaccattaatacaatacaaaa |
52387900 |
T |
 |
| Q |
157 |
tatcaatgt--agtcattgaaagacttggttatttccatccaattctctatcttgtttgtcagatgtgaacattgaatcagtaattttcacccatacatc |
254 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52387901 |
tatcaatgtgtagtcattgaaagacttggttatttccatccaattctctatcttgtttgtcagatgtgaacattgaatcagtaattttcacccatacatc |
52388000 |
T |
 |
| Q |
255 |
cataaatttgaaccttaagaacccctactattgctaccaaacta |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52388001 |
cataaatttgaaccttaagaacccctactattgctaccaaacta |
52388044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 164 - 273
Target Start/End: Complemental strand, 32921158 - 32921049
Alignment:
| Q |
164 |
gtagtcattgaaagacttggttatttccatccaattctctatcttgtttgtcagatgtgaacattgaatcagtaattttcacccatacatccataaattt |
263 |
Q |
| |
|
|||| |||| |||||||||||||| |||||| |||||||||||||||||||||| ||| |||| ||||||| ||| || ||||| ||| |||||||||| |
|
|
| T |
32921158 |
gtagccattaaaagacttggttatgtccatctaattctctatcttgtttgtcagctgtcaacactgaatcactaagttctacccaaacagccataaattt |
32921059 |
T |
 |
| Q |
264 |
gaaccttaag |
273 |
Q |
| |
|
|| ||||||| |
|
|
| T |
32921058 |
gagccttaag |
32921049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University