View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4929-Insertion-5 (Length: 153)
Name: NF4929-Insertion-5
Description: NF4929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4929-Insertion-5 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 2e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 153
Target Start/End: Original strand, 2441099 - 2441244
Alignment:
| Q |
8 |
ggaattgactgccattaacaagcagctcttgtgtgtcctccctaccttaagctcttctggccattcactttacgacccgccacttcctacgcttccgttt |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2441099 |
ggaattgactgccattaacaagcagttcttgtgtgtcctccctaccttaagctcttctggccattcactttatgacccgccacttcctacgcttccgttt |
2441198 |
T |
|
| Q |
108 |
gatttggtggcagagatcctgtgtaggctacctgtgaagctcctcc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2441199 |
gatttggtggcagagatcctgtgtaggctacctgtgaagctcctcc |
2441244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 145
Target Start/End: Original strand, 13525782 - 13525830
Alignment:
| Q |
97 |
cgcttccgtttgatttggtggcagagatcctgtgtaggctacctgtgaa |
145 |
Q |
| |
|
||||||| |||||||||||| ||||||| || |||||||| |||||||| |
|
|
| T |
13525782 |
cgcttccctttgatttggtgccagagattctttgtaggcttcctgtgaa |
13525830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University