View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4930-Insertion-5 (Length: 248)
Name: NF4930-Insertion-5
Description: NF4930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4930-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 43 - 167
Target Start/End: Complemental strand, 42162009 - 42161885
Alignment:
| Q |
43 |
agtaaataaacggtctaactatgtcattttagatagcaaaatcaatttttataaaaacattcatgaatctaggagatttaaatacgacaagcatattgtt |
142 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
42162009 |
agtaaataaactgtctaactatgtcattttagatggcaaaatcaatttttataaaaacatacatgaatctaggagatttagataggacaagcatattgtt |
42161910 |
T |
|
| Q |
143 |
ggaatttactcgctcttactttaga |
167 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42161909 |
ggaatttactcgctcttactttaga |
42161885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 42161844 - 42161803
Alignment:
| Q |
207 |
atatatattttaatttatatattgacatgttgcccttccttg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42161844 |
atatatattttaatttatatattgacatgttgcccttccttg |
42161803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University