View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4930_high_5 (Length: 226)
Name: NF4930_high_5
Description: NF4930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4930_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 218
Target Start/End: Complemental strand, 7304707 - 7304496
Alignment:
| Q |
7 |
gaaagcctgtgaaaactatagtggtgccgatcttgctgcattggttggtctctgatctatttttctttccttgtattatctctattctatttagagggcg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
7304707 |
gaaagcctgtgaaaactatagtggtgccgatcttgctgcattggttggtctctgatctatttttcttttcttgtattatctctattctatttagaaggca |
7304608 |
T |
|
| Q |
107 |
agccttggcgcaacggttaggttgttgccatgtaacaatgatgttacgggtttaagtatttcaaacaaactctctgcttgtaagggtaaagctgcgtgca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7304607 |
agccttggcgcaacggttaggttgttgccatgtaacaatgatgttacgggtttaaatatttcaaacaaactctctgcttgtaagggtaaagctgtgtgca |
7304508 |
T |
|
| Q |
207 |
tctaccctcccc |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7304507 |
tctaccctcccc |
7304496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 7295473 - 7295340
Alignment:
| Q |
7 |
gaaagcctgtgaaaactatagtggtgccgatcttgctgcattggttggtctctgatctattt--ttctttccttgtattatctctattctatttagaggg |
104 |
Q |
| |
|
|||||| ||| |||||| || |||||| |||||||||||||||||| ||||||| || ||| || || ||||| | || |||||| ||||||||| |
|
|
| T |
7295473 |
gaaagcttgtaaaaactttaatggtgctgatcttgctgcattggtttgtctctgcgctctttcgttggtta-ttgtaatctccttattctttttagaggg |
7295375 |
T |
|
| Q |
105 |
cgagccttggcgcaacggttaggttgttgccatgt |
139 |
Q |
| |
|
| |||||||||||||||| ||||||||||||||| |
|
|
| T |
7295374 |
tgggccttggcgcaacggtaaggttgttgccatgt |
7295340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 135
Target Start/End: Complemental strand, 21333139 - 21333101
Alignment:
| Q |
97 |
ttagagggcgagccttggcgcaacggttaggttgttgcc |
135 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
21333139 |
ttagagggcgagccttggcacaacggtgaggttgttgcc |
21333101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University