View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4930_high_5 (Length: 226)

Name: NF4930_high_5
Description: NF4930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4930_high_5
NF4930_high_5
[»] chr3 (2 HSPs)
chr3 (7-218)||(7304496-7304707)
chr3 (7-139)||(7295340-7295473)
[»] chr7 (1 HSPs)
chr7 (97-135)||(21333101-21333139)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 218
Target Start/End: Complemental strand, 7304707 - 7304496
Alignment:
7 gaaagcctgtgaaaactatagtggtgccgatcttgctgcattggttggtctctgatctatttttctttccttgtattatctctattctatttagagggcg 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||     
7304707 gaaagcctgtgaaaactatagtggtgccgatcttgctgcattggttggtctctgatctatttttcttttcttgtattatctctattctatttagaaggca 7304608  T
107 agccttggcgcaacggttaggttgttgccatgtaacaatgatgttacgggtttaagtatttcaaacaaactctctgcttgtaagggtaaagctgcgtgca 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||    
7304607 agccttggcgcaacggttaggttgttgccatgtaacaatgatgttacgggtttaaatatttcaaacaaactctctgcttgtaagggtaaagctgtgtgca 7304508  T
207 tctaccctcccc 218  Q
    ||||||||||||    
7304507 tctaccctcccc 7304496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 7295473 - 7295340
Alignment:
7 gaaagcctgtgaaaactatagtggtgccgatcttgctgcattggttggtctctgatctattt--ttctttccttgtattatctctattctatttagaggg 104  Q
    |||||| ||| |||||| || |||||| |||||||||||||||||| |||||||  || |||  ||  ||  ||||| | ||  |||||| |||||||||    
7295473 gaaagcttgtaaaaactttaatggtgctgatcttgctgcattggtttgtctctgcgctctttcgttggtta-ttgtaatctccttattctttttagaggg 7295375  T
105 cgagccttggcgcaacggttaggttgttgccatgt 139  Q
     | |||||||||||||||| |||||||||||||||    
7295374 tgggccttggcgcaacggtaaggttgttgccatgt 7295340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 135
Target Start/End: Complemental strand, 21333139 - 21333101
Alignment:
97 ttagagggcgagccttggcgcaacggttaggttgttgcc 135  Q
    ||||||||||||||||||| ||||||| |||||||||||    
21333139 ttagagggcgagccttggcacaacggtgaggttgttgcc 21333101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University