View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4930_high_6 (Length: 205)

Name: NF4930_high_6
Description: NF4930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4930_high_6
NF4930_high_6
[»] chr8 (1 HSPs)
chr8 (9-186)||(7078689-7078866)


Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 9 - 186
Target Start/End: Original strand, 7078689 - 7078866
Alignment:
9 gaggagcagagatagaagtagaaggagaaaatatgacaggacatgtagaatagtattggttgtttggaattggaattatgcttgcaattgcaactacacc 108  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7078689 gaggagcagggatagaagtagaaggagaaaatatgacaggacatgtagaatagtattggttgtttggaattggaattatgcttgcaattgcaactacacc 7078788  T
109 ttttggttttgaaataagcaaaagtgtgacataaacaaaaaataaagttatgattctcatggattgaggagcacaaga 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7078789 ttttggttttgaaataagcaaaagtgtgacataaacaaaaaataaagttatgattctcatggattgaggagcacaaga 7078866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University