View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4932_high_8 (Length: 227)
Name: NF4932_high_8
Description: NF4932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4932_high_8 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 16 - 211
Target Start/End: Original strand, 156053 - 156248
Alignment:
| Q |
16 |
atagggctaagcttgatgggatgtatgagtgtattttgtgtgcttgttgtagtacatcttgtcctagttattggtggaatcctgagtcttatcttggtcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
156053 |
atagggctaagcttgatgggatgtatgagtgtattttgtgtgcttgttgtagtacttcttgtcctagttattggtggaatcctgagtcttatcttggtcc |
156152 |
T |
 |
| Q |
116 |
tgctgctttgcttcatgctaataggtatgactttgtttttctatattttcagtttaatttgtgtgttgtgtaggaattgatttgggacggatacat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
156153 |
tgctgctttgcttcatgctaataggtatgactttgtttttctatattttcactttaatttgtgtgttgtgtaggaattgatttgggacggatacat |
156248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 16 - 142
Target Start/End: Original strand, 41504531 - 41504657
Alignment:
| Q |
16 |
atagggctaagcttgatgggatgtatgagtgtattttgtgtgcttgttgtagtacatcttgtcctagttattggtggaatcctgagtcttatcttggtcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504531 |
atagggctaagcttgatgggatgtatgagtgtattttgtgtgcttgttgtagtacttcttgtcctagttattggtggaatcctgagtcttatcttggtcc |
41504630 |
T |
 |
| Q |
116 |
tgctgctttgcttcatgctaataggta |
142 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41504631 |
tgctgctttgcttcatgctaataggta |
41504657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University