View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4932_low_9 (Length: 218)
Name: NF4932_low_9
Description: NF4932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4932_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 6011852 - 6011694
Alignment:
| Q |
18 |
atagtaagcaatactcatgcataaggtggtgctcctcttcatgatcccttcctactaaattcgcagctaaccagaaacaggttaaatgaagagnnnnnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
6011852 |
atagtaagcaatactcatgcataacgtggtgctc-tcttcatgatcccttcctactaaatccgcagctaaccaaaaacaggttaaatgaagag-aaaaaa |
6011755 |
T |
 |
| Q |
118 |
nnnnnnnnnnnccgaattatagtttgattagcatgatgttttttcaacagtgaccaatttc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6011754 |
gaatgaaaaaaccgaattatagtttgattagcatgatgttttttcaacagcgaccaatttc |
6011694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University