View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4933-Insertion-5 (Length: 43)
Name: NF4933-Insertion-5
Description: NF4933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4933-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.0000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.0000000000006
Query Start/End: Original strand, 7 - 43
Target Start/End: Complemental strand, 35407006 - 35406970
Alignment:
| Q |
7 |
aatattatcactatcaacattctcatctctctccatt |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35407006 |
aatattatcactatcaacattctcatctctctccatt |
35406970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University