View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4934-Insertion-11 (Length: 107)
Name: NF4934-Insertion-11
Description: NF4934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4934-Insertion-11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 52668332 - 52668428
Alignment:
| Q |
8 |
cttccaagcctccacagtgtgaactccgatcacttgtccctcttctgctgccatttttctctttcttcgtgcaaattacgcttttgctttcaaatgt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52668332 |
cttccaagcctccacagtgtgaactccgatcacgtgtccctcttctgctgccatttttttctttcttcgtacaaattacgcttttgctttcaaatgt |
52668428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 28; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 27 - 70
Target Start/End: Original strand, 7354620 - 7354663
Alignment:
| Q |
27 |
tgaactccgatcacttgtccctcttctgctgccatttttctctt |
70 |
Q |
| |
|
||||| |||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
7354620 |
tgaacaccgatcacctgtccttcttcagctgccatttttctctt |
7354663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University