View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4934-Insertion-13 (Length: 170)
Name: NF4934-Insertion-13
Description: NF4934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4934-Insertion-13 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 4638053 - 4638007
Alignment:
| Q |
124 |
atgaatgttggataatgtttctaaaaattgatttatatgtttttggg |
170 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4638053 |
atgaatgttggataatgtttcttaaaattgatttatatgtttttggg |
4638007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 4638169 - 4638133
Alignment:
| Q |
8 |
atcaagcataaggttttgtgattctgggagttggtgc |
44 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4638169 |
atcaagcataaggttttgtgattctgggagttggtgc |
4638133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 124 - 170
Target Start/End: Complemental strand, 27261434 - 27261388
Alignment:
| Q |
124 |
atgaatgttggataatgtttctaaaaattgatttatatgtttttggg |
170 |
Q |
| |
|
|||| |||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
27261434 |
atgagtgttggttaatgttttttaaaattgatttatatgtttttggg |
27261388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University