View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4934-Insertion-14 (Length: 45)
Name: NF4934-Insertion-14
Description: NF4934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4934-Insertion-14 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 39; Significance: 0.00000000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.00000000000004
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 33827066 - 33827104
Alignment:
| Q |
7 |
atttttatattgcaaaaatgtgaaggaaggaagtacgtg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33827066 |
atttttatattgcaaaaatgtgaaggaaggaagtacgtg |
33827104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.00000000000004
Query Start/End: Original strand, 7 - 45
Target Start/End: Complemental strand, 33840899 - 33840861
Alignment:
| Q |
7 |
atttttatattgcaaaaatgtgaaggaaggaagtacgtg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33840899 |
atttttatattgcaaaaatgtgaaggaaggaagtacgtg |
33840861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University