View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4934_high_21 (Length: 236)
Name: NF4934_high_21
Description: NF4934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4934_high_21 |
 |  |
|
| [»] scaffold0086 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 44 - 223
Target Start/End: Original strand, 27275 - 27454
Alignment:
| Q |
44 |
atatgggacgaatcactcacgtttaaatcccaataattttgaatattgagcattggttcaatgccaacagtagggattaataaatgcttgctgtatccct |
143 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27275 |
atatgggactaatcactcacgtttaaattccaataattttgaatattgagcattggttcaatgccaacagtagggattaataaatgcttcttgtatccct |
27374 |
T |
 |
| Q |
144 |
ttgaagagcttattgtaataataaatggagcagccaaagaaataaagaagaaaacaaattaggtatgactgtgactaatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27375 |
ttgaagagcttattgtaataataaatggagcagccaaagaaataaagaagaaaaaaaattaggtatgactgtgactaatg |
27454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 47
Target Start/End: Original strand, 27170 - 27203
Alignment:
| Q |
14 |
atcagtatcgataagagatctagagaccacatat |
47 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
27170 |
atcagcatcgataagagatctagagaccacatat |
27203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University