View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4934_low_16 (Length: 325)
Name: NF4934_low_16
Description: NF4934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4934_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 87 - 297
Target Start/End: Original strand, 37393861 - 37394068
Alignment:
| Q |
87 |
aatctgaattagccattaaaaataccactcacttttctta-atgattttaattcttttttgcctctcaagtttgatggttgttattctcctttgagaggt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37393861 |
aatctgaattagccattaaaaataccactaactttttttttacgattttaattcttttttgcctctcaagtttgatggttgttattctcctttgagagga |
37393960 |
T |
|
| Q |
186 |
ttctcaatgaagatatcccatttttnnnnnnnttgtgaagtaaaattttaaacaaactttcagactttatcatgctttaaaaaatatcagaacatatctt |
285 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37393961 |
ttctcaatgaagatatcccattttttaaaaaattgtgaagtaaaattttaaacaaact----gactttatcatgctttaaaaaatatcataacatatctt |
37394056 |
T |
|
| Q |
286 |
aaaaatgattat |
297 |
Q |
| |
|
|||||||||||| |
|
|
| T |
37394057 |
aaaaatgattat |
37394068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 60
Target Start/End: Original strand, 37393778 - 37393834
Alignment:
| Q |
5 |
gagtagcataggttttcgtaa--aataaaaaataagatttggatcctctctatcttac |
60 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
37393778 |
gagtagcgtaggttttcgtaagaaataaaaaata-gatttggatcctctctattttac |
37393834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University