View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4934_low_23 (Length: 260)
Name: NF4934_low_23
Description: NF4934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4934_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 22191733 - 22191491
Alignment:
| Q |
1 |
gcgtgccacatgctatactcagctctcttcaactagctcttgaatttggtt-ctctaatgtgtaaatcgagtctgatcgtaaggnnnnnnn-acaatgct |
98 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
22191733 |
gcgtgccacattctatactcagctctcttcaactagctcttgaatttggtttctctaatgtgtaaatcgagtctgatcgtaaggttttttttacaattct |
22191634 |
T |
|
| Q |
99 |
acaaggattcg----ttttcaccaatgttctaggcttgactatatcacaatgtccgaggcattagtacggtattcattgactgcagaaaatcaatatggt |
194 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
22191633 |
acaaggattcgagggttttcaccaatgttctaggcttgactatatcacaatgtccgaggcattagtacggtattcattgactgaagaaaattaatatggt |
22191534 |
T |
|
| Q |
195 |
ctgacagttggttttggct---tgttatcatggttttattttt |
234 |
Q |
| |
|
| ||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
22191533 |
ccgacagttggttttggcttgttgttatcatggtttttttttt |
22191491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University