View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4937_high_4 (Length: 249)
Name: NF4937_high_4
Description: NF4937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4937_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 43245686 - 43245514
Alignment:
| Q |
1 |
aaaaggttgggtgaataacaaattctccttcttgtcctatgtataagagatgttttaatcaataaaaatttataaattatacgtcaatttcagttaagtc |
100 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
43245686 |
aaaagtttgggtgagtaacaaattctccttcttgtcctatg----agagatgtttgaatcaataaaaatttataaattatatgtcaatttcagtcaagtc |
43245591 |
T |
 |
| Q |
101 |
agacatcccttttataaatagaatcggagggagtaaaaacgaagagttaggaagggttgctaaaaatataatgacca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43245590 |
agacatcccttttataaatagaatcggagggagtaaaaaagaagagttaggaagggttgctaaaaatataatgacca |
43245514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 132 - 165
Target Start/End: Complemental strand, 39866909 - 39866876
Alignment:
| Q |
132 |
agtaaaaacgaagagttaggaagggttgctaaaa |
165 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
39866909 |
agtaaaaacgaagagttaggaatggttgctaaaa |
39866876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University