View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4937_low_9 (Length: 202)
Name: NF4937_low_9
Description: NF4937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4937_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 12 - 120
Target Start/End: Original strand, 39628055 - 39628163
Alignment:
| Q |
12 |
agtgagatgaacaaaatttgtaagcaatagatgtggccacacacgatttcctttcttctctccaactcattgtcaaatcgtctatgcttagaggtctgaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
39628055 |
agtgagatgaacaaaatttgtaagcaatagatgtggccacacacgatttcctttcttctctccaactcaatgtcaaatcgtctatgcttaggggtctgaa |
39628154 |
T |
 |
| Q |
112 |
ttcgaatac |
120 |
Q |
| |
|
||||||||| |
|
|
| T |
39628155 |
ttcgaatac |
39628163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University