View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4938_high_6 (Length: 240)
Name: NF4938_high_6
Description: NF4938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4938_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 5 - 225
Target Start/End: Complemental strand, 47624421 - 47624201
Alignment:
| Q |
5 |
gtgcaggttgcctgggaaggtcttatcgatgcccttatttctcatccaatattggtttcagagaaaaagacaccatctaaggatacttctctccagaaac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47624421 |
gtgcaggttgcctgggaaggtcttatcgatgcccttatttctcatccaatattggtttcagagaaaaagacaccgtctaaggatacttctctccagaaac |
47624322 |
T |
 |
| Q |
105 |
agcattcatctagtaagaccaattgtgtggatcaagtaaatgggatttacaaaagcataaaacttataatgactccactgattggcattgtgtctagtaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624321 |
agcattcatctagtaagaccaattgtgtggatcaagtaaatgggatttacaaaagcataaaacttataatgactccactgattggcattgtgtctagtaa |
47624222 |
T |
 |
| Q |
205 |
atgtgatatatcagttcattc |
225 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47624221 |
atgtgatatatcagttcattc |
47624201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University