View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4938_low_4 (Length: 345)

Name: NF4938_low_4
Description: NF4938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4938_low_4
NF4938_low_4
[»] chr3 (3 HSPs)
chr3 (22-113)||(31426786-31426877)
chr3 (268-340)||(31423694-31423766)
chr3 (147-202)||(31423573-31423628)
[»] chr2 (1 HSPs)
chr2 (22-107)||(7171753-7171838)


Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 31426877 - 31426786
Alignment:
Q  22 gtcgattccttcagccttgtaaatcatcacatgcaaagcaactttgaattcttctgtgaggatgcttttgctcttttggtttgcatggttca 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  31426877 gtcgattccttcagccttgtaaatcatcacatgcaaagcaactttgaattcttctgtgaggatgcttttgctcttttggtttgcattgttca 31426786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 268 - 340
Target Start/End: Original strand, 31423694 - 31423766
Alignment:
Q  268 agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtgtggctggtgatgatgt 340  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  31423694 agagagggtgccgtcagcgggaacaacagagatggtggtgcaaggtggttgttggtatggctggtgatgatgt 31423766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 147 - 202
Target Start/End: Original strand, 31423573 - 31423628
Alignment:
Q  147 tcacggttgttttgttgttcacagattttgaggtggttgctgagtttgaatgttga 202  Q
    |||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
T  31423573 tcacggttgtgttgttgttcacggattttgaggtggttgctgagtttgaatgttga 31423628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 22 - 107
Target Start/End: Complemental strand, 7171838 - 7171753
Alignment:
Q  22 gtcgattccttcagccttgtaaatcatcacatgcaaagcaactttgaattcttctgtgaggatgcttttgctcttttggtttgcat 107  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||    
T  7171838 gtcgattccttcagccttgaaaatcatcacatgcaaagcaactttgaattcttctgtgatgatgcttttgctcttttggtctgcat 7171753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University