View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4938_low_5 (Length: 312)
Name: NF4938_low_5
Description: NF4938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4938_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 190 - 294
Target Start/End: Complemental strand, 20272559 - 20272455
Alignment:
| Q |
190 |
tgaaggggtgcctgcaaaagatattgtgaagcccaaagtaaagagatgcgctaggaggtagtagcaagtaagatatgaaagagtgaacctacaacctagc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20272559 |
tgaaggggtgcctgcaaaagatattgtgaagcccaaagtaaagagatgcgctaggaggtagtagcaagtaagatatgaaagagtgaacctacaacctagc |
20272460 |
T |
 |
| Q |
290 |
atact |
294 |
Q |
| |
|
||||| |
|
|
| T |
20272459 |
atact |
20272455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University